Mutacja w genie receptora V2 w wazopresynie u spokrewnionego z mylącym moczowodem prostym z cukrzycą sprzężoną z chromosomem X cd

Wazopresynę argininy w osoczu mierzono modyfikacją13 opisanego uprzednio testu radioimmunologicznego14. Wyniki wykazały całkowitą niewydolność nerek na wazopresynę w probandzie, z maksymalnie rozcieńczonym moczem pomimo wysokich stężeń wazopresyny argininowej w osoczu. Podskórne podanie 2 .g desmopresyny nie zwiększyło osmolalności moczu. Matka miała częściową oporność nerek na wazopresynę, z prawostronną zmianą krzywej związanej z wazopresyną argininową w osoczu z osmolalnością w moczu. Przygotowanie i analiza DNA
Genomowy DNA wyizolowano z krwi pacjentów i osób kontrolnych, jak opisano wcześniej15. Analizę Southern blot przeprowadzono z DNA (20 .g na ścieżkę) strawionym endonukleazą restrykcyjną Hindlll, BamHI lub Xball. Bloty sondowano wyznakowanym 32P fragmentem 428-bp (parą zasad) cDNA ludzkiego receptora V2. Sekwencje starterów oligonukleotydowych stosowanych do reakcji łańcuchowej polimerazy (PCR) 16 to 5 CTTGGGCCTTCTCGCTCCTTCTCAGCCTGC3 i 5 CGTCATCCTCACAGTCTTGGCCACAGC3 , które dają fragment 332 bp kodujący region rozciągający się od czwartej do szóstej domeny transbłonowej Receptor V2. PCR przeprowadzono za pomocą .g genomowego DNA, 500 nmoli każdego oligonukleotydu na litr, 200 .mol każdego nukleotydowego trifosforanu na litr, 1,5 mmol chlorku magnezu na litr i 2,5 U polimerazy Taq DNA w standardowym buforze do PCR (Perkin -Elmer Cetus) w końcowej objętości 100 mikrolitrów. Reakcje przeprowadzono za pomocą termocyklera (Perkin-Elmer Cetus). Po wstępnym ogrzewaniu mieszaniny reakcyjnej do 94 ° C przez 5 minut, przeprowadzono 30 cykli dwuetapowej amplifikacji, z przyłączaniem i wydłużaniem razem w 72 ° C przez minutę, a następnie topienie w 94 ° C przez 45 sekund; etap końcowego wyżarzania i przedłużania trwał 3 minuty. Ta reakcja dała pojedynczy pas DNA o odpowiedniej wielkości, który oczyszczono dostępną w handlu żywicą na bazie krzemu (Magic PCR Preps, Promega). Produkt PCR był następnie traktowany polimerazą DNA T4 i kinazą polinukleotydową T4 (New England Biolabs) w celu wygenerowania tępych, fosforylowanych końców do subklonowania do miejsca HincII M13mp18, lub trawienia przez noc z restrykcyjną endonukleazą Earl. Sekwencjonowanie jednoniciowego DNA endonukleazy przeprowadzono na wielu subklonach11.
Wyniki
Figura 3. Figura 3. Molekularna analiza genetyczna sekwencji DNA i białka receptora wazopresyny V2 u normalnego podmiotu i pacjenta z moczowodem prostym cukrzycowym. Górny panel pokazuje sekwencję DNA u normalnego osobnika i probanda. Sekwencje DNA i białka odczytuje się od dołu do góry (strzałka po lewej). Wstawienie reszty cytozyny (podwójna strzałka) zakłóca ramkę odczytu translacji białka. Pierwsze trzy nieprawidłowe aminokwasy (czcionka pogrubiona) wynikające z przesunięcia ramki są wyświetlane w prawym górnym rogu.
Dolny panel pokazuje konsekwencje mutacji przesunięcia ramki w przewidywanym produkcie białkowym w probandzie. Od momentu wstawienia pary zasad przesunięcie białka jest przesunięte, co powoduje sekwencję missense. Ponadto, po około 20 resztach aminokwasowych sekwencji missense, występuje przedwczesny kodon stop, który zatrzymuje syntezę białek
[podobne: hashimoto objawy psychiczne, rehabilitacja sportowa kraków, fasardi allegro ]