Wada molekularna w genie receptora V2 w wazopresynie powodująca nudne moczowód cukrzycowy ad

Protokół badania został zatwierdzony przez instytucjonalną komisję odwoławczą Szpitala Dziecięcego (Boston), a świadomą zgodę uzyskano od wszystkich badanych osób. Screening for Mutations
Genomowy DNA wyizolowano z próbek krwi obwodowej uzyskanych od 22 członków rodziny, zgodnie ze standardowymi technikami13. Początkowe badania przesiewowe pod kątem mutacji przeprowadzono przez sekwencjonowanie subklonowanych produktów reakcji łańcuchowej polimerazy (PCR) z genomowego DNA dwóch dotkniętych członków rodziny (podmiot II-10 i podmiot II-11) i jednego normalnego członka (podmiot II-7) jako Opisane poniżej. Sekwencje DNA odbiegające od zgłoszonej sekwencji ludzkiego receptora wazopresyny V214 zostały potwierdzone przez sekwencjonowanie co najmniej dwóch dodatkowych niezależnych klonów. Po scharakteryzowaniu mutacji w tych elementach rodziny, 15 innych członków przeszukiwano przez bezpośrednie sekwencjonowanie produktów PCR amplifikowanych z genomowego DNA15. Przeanalizowaliśmy również DNA 21 członków poprzez amplifikację PCR 3 -niedopasowanego primera16.
Amplifikacja i subklonowanie PCR
Cztery zestawy starterów oligonukleotydowych użyto do powielenia zachodzących na siebie segmentów całej sekwencji kodującej genu receptora V2 wazopresyny. Każda mieszanina reakcyjna zawierała .g genomowego DNA, 100 pmol każdego startera i roztwory zawierające standardowy bufor i trifosforany deoksynukleotydowe. PCR przeprowadzono w temperaturze 95 ° C przez pięć minut, a następnie przez 28 cykli w następujących temperaturach: 94 ° C przez jedną minutę, 62 ° C przez dwie minuty i 72 ° C przez dwie minuty, z końcowym wydłużeniem 72 ° C. ° C przez siedem minut. Oczyszczone i subklonowane produkty PCR sekwencjonowano zgodnie ze standardowymi metodami13.
Mutacja w oparciu o PCR
Niedawno opracowane podejście do identyfikacji mutacji – oporna mutacja amplifikacji16 – zostało użyte w analizie wszystkich chorych i normalnych osób w badaniu. Jest to ogólna metoda analizy mutacji punktowych lub delecji; opiera się na niedopasowaniu reszty hydroksylowej 3 w starterze PCR, który nie działa prawidłowo w reakcjach PCR w odpowiednich warunkach. Zaprojektowaliśmy dwie pary oligonukleotydów do amplifikacji sekwencji DNA typu dzikiego lub sekwencji zmutowanej i wykorzystano je w reakcjach PCR. Startery typu dzikiego były (do przodu) 5 GGGCCAGATGCCCTGTGTC3 i (odwrócone) 5 CATTCTAGATCACGATGAAGTGTCCTTGGCCAGGGA3 ; zmutowanymi starterami były (do przodu) 5 GGGCCAGATGCCCTGTGTT3 i (odwrotne) 5 CATTCTAGATCACGATGAAGTGTCCTTGGCCAGGGA3 . Warunki PCR były takie same, jak opisano powyżej, z tym wyjątkiem, że temperatura hybrydyzacji wynosiła 64 ° C.
Bezpośrednie sekwencjonowanie PCR
W celu określenia genotypu każdego chorego osobnika i zweryfikowania wyników opartej na PCR amplifikacji opornej na mutację, przeprowadzono bezpośrednie sekwencjonowanie produktów PCR dla każdego z członków rodziny wskazanych na Fig. 1. Po amplifikacji .g genomowego DNA po reakcji PCR uzyskany kwas nukleinowy ekstrahowano alkoholem fenolo-chloroform-izoamylowym, zatężono i oczyszczono. Oczyszczony produkt PCR zastosowano jako matrycę do sekwencjonowania dideoksy-DNA z wewnętrznymi starterami do sekwencjonowania.
Analiza sprzężeń
Genotypy 22 osobników, których DNA zostało zsekwencjonowane lub określone za pomocą PCR (lub obu), analizowano pod kątem powiązania genetycznego z wrodzonymi moczowoczymi moczowokomórkowymi nerkami za pomocą programów LIPIN i LIPED, 17,18 przy założeniu, że cecha była powiązana z X i recesywny, z całkowitą penetracją i procentową częstotliwością dotkniętego allelu w normalnej populacji.
Wyniki
Figura przedstawia trzy pokolenia rodziny z wrodzonym moczowodem prostej nerki; większość członków to długoletni mieszkańcy miasteczka w centrum Maine
[patrz też: leki od a do z, ebola okres inkubacji, echo serca poznań ]